Top » Catalog » SNPs » FGC10516

$18.00

FGC10516
[FGC10516]

FGC10516
hg38 Position: ChrY:7281048..7281048
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a2b1 (not listed)
Comments: Found in a U152+ L2+ FGC10543+ sample
Forward Primer: FGC10516_F GACCTCTGTGTGTTGGAGTCG
Reverse Primer: FGC10516_R AAATAATGTTAATATTGTCATGGTGGAAC
Reviews

Customers who bought this product also purchased
BY25318
BY25318
FT410015
FT410015
A1718
A1718
BY25320
BY25320
Y3964
Y3964
BY169025
BY169025
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies