Top » Catalog » SNPs » CTS11248

$18.00

CTS11248
[CTS11248]

CTS11248
hg38 Position: ChrY:20871353..20871353
Ancestral: G
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1a
Comments: Equivalent to M132
Forward Primer: CTS11248_F TTATTTAAAGAGTCAACAACTCATGAGTC
Reverse Primer: CTS11248_R ATCAAATCAGTGGGAAACCATTAG
Reviews

Customers who bought this product also purchased
YSEQ-Alpha
YSEQ-Alpha
U290
U290
CTS10652
CTS10652
M4232
M4232
V2580
V2580
E1b-U175 "Bantu Expansion" Panel
E1b-U175 "Bantu Expansion" Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
2 x A13906
2 x A11115
$72.00
Haplogroup Info
Other products
Currencies