Top » Catalog » SNPs » S566

$19.00

S566
[S566]

S566
hg38 Position: ChrY:13607202..13607202
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1c1
Comments: Aka FGC453
Forward Primer: S566_F GCCAAGCAAGAAAGATTCAGC
Reverse Primer: S566_R GCCTGGTCCTTTCTCCATAG
Reviews

Customers who bought this product also purchased
DF85
DF85
A259
A259
A2501
A2501
A223
A223
A738
A738
FGC23742
FGC23742
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies