Top » Catalog » SNPs » FT49932

$19.00

FT49932
[FT49932]

FT49932
hg38 Position: ChrY:9243472..9243472
Ancestral: T
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT49932_F CCCCACAGATGCAACCG
Reverse Primer: FT49932_R TGATAAATATGCCCAATAAGTATAATTGC
Reviews

Customers who bought this product also purchased
FT378486
FT378486
Z2109
Z2109
FTA68431
FTA68431
BY206237
BY206237
FT248250
FT248250
DNA Sample Kit
DNA Sample Kit
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies