Top » Catalog » SNPs » L1335

$18.00

L1335
[L1335]

L1335
hg38 Position: ChrY:20992315..20992315
Ancestral: A
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2c1k
Comments: Found in a hg R-L21 WTY participant
Forward Primer: L1335_F CTACTCTAAAAGTGTCCAGTATTCAAGC
Reverse Primer: L1335_R TGGGTAGGCATGTCACTGG
Reviews

Customers who bought this product also purchased
Y150210
Y150210
A10528
A10528
BY108617
BY108617
A18726
A18726
FGC32795
FGC32795
ZS8379
ZS8379
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies