Top » Catalog » SNPs » FGC30690

$18.00

FGC30690
[FGC30690]

FGC30690
hg38 Position: ChrY:10059971..10059971
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S588
Forward Primer: FGC30690_F TCTGTTTCAATGACCCCAGG
Reverse Primer: FGC30690_R TGGGTCCTCAGGACCTTTTG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies