Top » Catalog » SNPs » Y179930

$19.00

Y179930
[Y179930]

Y179930
hg38 Position: ChrY:14956447..14956447
Ancestral: G
Derived: A
Reference: YFull (2019)
ISOGG Haplogroup: E1b
Comments: Below Z834 > M34 > Y4971
Forward Primer: Y179930_F ATAAGAGGGATATCACCACCAATG
Reverse Primer: Y179930_R ATTCAGTATGATATGGGTTGTGGT
Reviews

Customers who bought this product also purchased
Y194370
Y194370
Y4970
Y4970
BY141576
BY141576
Y22843
Y22843
Y6938
Y6938
A10728
A10728
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies