Top » Catalog » SNPs » A7729

$18.00

A7729
[A7729]

A7729
hg38 Position: ChrY:14762744..14762744
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a (not listed)
Comments: L161 subclade Isles C. Below A544
Forward Primer: A7729_F TAACTGTAGTGTAAACACGCTAATGC
Reverse Primer: A7729_R CTTCCAGCCAAATGAATAAACAC
Reviews

Customers who bought this product also purchased
FGC14463
FGC14463
Y3734
Y3734
FGC7156
FGC7156
I2a-M423 Panel
I2a-M423 Panel
A544
A544
FGC7174
FGC7174
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies