Top » Catalog » SNPs » FGC452

$19.00

FGC452
[FGC452]

FGC452
hg38 Position: ChrY:13500186..13500186
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b (not listed)
Comments: Found in a PF1169 sample
Forward Primer: FGC452_F AGGTGCCTGTAACCCCAGTC
Reverse Primer: FGC452_R ACTCCACCTGGCTTATCTGG
Reviews

Customers who bought this product also purchased
R1b-PF1169 panel
R1b-PF1169 panel
S556
S556
S562
S562
S567
S567
S555
S555
S560
S560
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies