Top » Catalog » SNPs » Y18393

$19.00

Y18393
[Y18393]

Y18393
hg38 Position: ChrY:15197451..15197451
Ancestral: G
Derived: T
Reference: YFull (2015)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: Y18393_F ATGGCTGAACTTACCTAGAATGC
Reverse Primer: Y18393_R CTGGGCAACACAGTAAGATCC
Reviews

Customers who bought this product also purchased
FT3442
FT3442
ZS8639
ZS8639
FT14076
FT14076
J1-S4924 Panel
J1-S4924 Panel
Y94943
Y94943
A7729
A7729
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies