Top » Catalog » SNPs » SK1335

$19.00

SK1335
[SK1335]

SK1335
hg38 Position: ChrY:15709165..15709165
Ancestral: G
Derived: A
Reference: Mark Stoneking and Ryan Wei (2014)
ISOGG Haplogroup: J2a1a1b*
Comments: Equal or downstream M67
Forward Primer: SK1335_F TCTGGTCAACCAGGTTAGGTG
Reverse Primer: SK1335_R TGGGGTTATGAGATTCCAAC
Reviews

Customers who bought this product also purchased
M12
M12
Y16179
Y16179
Z6271
Z6271
PH1882
PH1882
Y144571
Y144571
FT281366
FT281366
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies