Top » Catalog » SNPs » A4604

$19.00

A4604
[A4604]

A4604
hg38 Position: ChrY:7103243..7103243
Ancestral: G
Derived: T
Reference: William Hartley (2015)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream DF13 > S1051
Forward Primer: A4604_F AGGAGTTCAAGGCTGCAATG
Reverse Primer: A4604_R AAGGCAGGTTTACCACCCTAG
Reviews

Customers who bought this product also purchased
FGC17938
FGC17938
FGC9854
FGC9854
R1b-S1051 Panel
R1b-S1051 Panel
FGC9682
FGC9682
S1050
S1050
S1051
S1051
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies