Top » Catalog » SNPs » U290

$18.00

U290
[U290]

U290
hg38 Position: ChrY:19484172..19484172
Ancestral: T
Derived: A
Reference: Sims et al. 2007
ISOGG Haplogroup: E1b1a1a1a2a1a3b1a
Comments: Below CTS1238/M3990
Forward Primer: U290_F CTCAGAGAATATGTCTGCAACAGC
Reverse Primer: U290_R CCAGCTGCTATGTTTTCCAG
Reviews

Customers who bought this product also purchased
CTS10652
CTS10652
E Superclade Panel
E Superclade Panel
M4231
M4231
V2580
V2580
M96
M96
CTS11248
CTS11248
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies