Top » Catalog » SNPs » MF5057

$19.00

MF5057
[MF5057]

MF5057
hg38 Position: ChrY:17015008..17015008
Ancestral: A
Derived: G
Reference: 23mofang (2018)
ISOGG Haplogroup: R1b
Comments: Below Z2103 > Z2108 > Z2705 > Y126039
Forward Primer: MF5057_F AATTTAGCTGGGCATGTTGG
Reverse Primer: MF5057_R TCTGCCATATGTAGGAACATGG
Reviews

Customers who bought this product also purchased
M172
M172
PH2535
PH2535
M343
M343
A1777
A1777
V13
V13
BY250
BY250
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies