Top » Catalog » SNPs » DF104

$18.00

DF104
[DF104]

DF104
hg38 Position: ChrY:2937793..2937793
Ancestral: C
Derived: T
Reference: Andy Gierson (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1
Comments: .
Forward Primer: DF104_F GACTGCTGCTTCGTTTTTGC
Reverse Primer: DF104_R CAGCAATCTCTAGTTCCCTTCAG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies