Top » Catalog » SNPs » M184

$18.00

M184
[M184]

M184
hg38 Position: ChrY:12786229..12786229
Ancestral: G
Derived: A
Reference: Underhill et al. 2001
ISOGG Haplogroup: T
Comments: Dffryexon23
Forward Primer: M184_F TTTCCTTTCTGTCTGCAGTGG
Reverse Primer: M184_R TTTTGCAAAGGCAAAAACC
Reviews

Customers who bought this product also purchased
M172
M172
P77
P77
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
PF7562
PF7562
BY16680
BY16680
M343
M343
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies