Top » Catalog » SNPs » Z17807

$18.00

Z17807
[Z17807]

Z17807
hg38 Position: ChrY:15911455..15911455
Ancestral: T
Derived: C
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of L513>S6365
Forward Primer: Z17807_F CGTTTAGCTGGTTGAATGAATG
Reverse Primer: Z17807_R GGGCATGGTAGTGGACATC
Reviews

Customers who bought this product also purchased
BY359
BY359
S6365
S6365
L1333
L1333
L513
L513
Z16385
Z16385
Z39589
Z39589
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
2 x A13906
2 x A11115
2 x J2a-M67 Panel
$248.00
Haplogroup Info
Other products
Currencies