Top » Catalog » SNPs » S590

$19.00

S590
[S590]

S590
hg38 Position: ChrY:17298578..17298578
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Downstream S603
Forward Primer: S590_F TCAACCCAGACACATCCTTC
Reverse Primer: S590_R TGTTGATGAAAAGAGCCAAATTC
Reviews

Customers who bought this product also purchased
M173
M173
M9
M9
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
BY159752
BY159752
L21
L21
M343
M343
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies