Top » Catalog » SNPs » S7814

$18.00

S7814
[S7814]

S7814
hg38 Position: ChrY:13364387..13364387
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a2a
Comments: Downstream of M222 > S588
Forward Primer: S7814_F TGAACATGTCTGCATGTCAAAG
Reverse Primer: S7814_R AAGGTGGGCGGATAATTTG
Reviews

Customers who bought this product also purchased
FGC10147
FGC10147
FGC16741
FGC16741
A5386
A5386
A10629
A10629
Y9391
Y9391
Y81784
Y81784
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies