Top » Catalog » SNPs » PF3293

$18.00

PF3293
[PF3293]

PF3293
hg38 Position: ChrY:10053232..10053232
Ancestral: T
Derived: C
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: G2a2b1b
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF3293_F AGTATAGAGAGATTGAAGAGTAGTGAGCA
Reverse Primer: PF3293_R AATGATAATCCCACAACCCTCA
Reviews

Customers who bought this product also purchased
CTS9957
CTS9957
Z6354
Z6354
M96
M96
Z6552
Z6552
Z30807
Z30807
M267
M267
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies