Top » Catalog » SNPs » Y32147

$18.00

Y32147
[Y32147]

Y32147
hg38 Position: ChrY:6805691..6805691
Ancestral: G
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: R1b
Comments: Below Z2103 > Y5592 > Y23373
Forward Primer: Y32147_F CTGATCTTGAGCTTCTGTGCTG
Reverse Primer: Y32147_R TTTATGTCTTCTGCATTCCACTG
Reviews

Customers who bought this product also purchased
FT63546
FT63546
BY218801
BY218801
BY105603
BY105603
Y82919
Y82919
Y33200
Y33200
A1777
A1777
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies