Top » Catalog » SNPs » Y32147

$18.00

Y32147
[Y32147]

Y32147
hg38 Position: ChrY:6805691..6805691
Ancestral: G
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: R1b
Comments: Below Z2103 > Y5592 > Y23373
Forward Primer: Y32147_F CTGATCTTGAGCTTCTGTGCTG
Reverse Primer: Y32147_R TTTATGTCTTCTGCATTCCACTG
Reviews

Customers who bought this product also purchased
Y85047
Y85047
Y153706
Y153706
A24000
A24000
BY199059
BY199059
FT51313
FT51313
Y84624
Y84624
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies