Top » Catalog » SNPs » S5955

$18.00

S5955
[S5955]

S5955
hg38 Position: ChrY:19509957..19509957
Ancestral: A
Derived: T
Reference: (Jim Wilson 2018)
ISOGG Haplogroup: R1b
Comments: Below L48, with S6898
Forward Primer: S5955_F ATGCAGGCATCTTTGAATG
Reverse Primer: S5955_R GCACAGGAATAAGTTAATCAGGG
Reviews

Customers who bought this product also purchased
S5957
S5957
S6911
S6911
R1b-S6898 Stout Panel
R1b-S6898 Stout Panel
S5953
S5953
S6910
S6910
S5952
S5952
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies