Top » Catalog » SNPs » A22918

$18.00

A22918
[A22918]

A22918
hg38 Position: ChrY:8196608..8196608
Ancestral: A
Derived: G
Reference: Elfatih Salim (2018)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A22918_F CTAGAACTCAGCATTAAGAAATATTCAG
Reverse Primer: A22918_R TTGCCTTAATTTCAGAACTGGTC
Reviews

Customers who bought this product also purchased
A22924
A22924
A22923
A22923
A22922
A22922
A22921
A22921
Y154841
Y154841
A22925
A22925
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies