Top » Catalog » SNPs » A2070

$19.00

A2070
[A2070]

A2070
hg38 Position: ChrY:12348852..12348852
Ancestral: G
Derived: A
Reference: Thomas Krahn (2012)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream MC14
Forward Primer: A2070_F TGTTCTCCCCAGCTCTGAAC
Reverse Primer: A2070_R TTAGTCGAGCATGGAGCAAG
Reviews

Customers who bought this product also purchased
L513
L513
MC14
MC14
U152
U152
A7298
A7298
DF13
DF13
CTS3386
CTS3386
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies