Top » Catalog » SNPs » FGC10147

$18.00

FGC10147
[FGC10147]

FGC10147
hg38 Position: ChrY:19754186..19754186
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Found in a R1b-M222 person. Downstream of S588 S7049
Forward Primer: FGC10147_F CATGCACGGTGTGCTACATC
Reverse Primer: FGC10147_R AGGTTGTCAGGTTAACACCCTAACT
Reviews

Customers who bought this product also purchased
S7814
S7814
Y81784
Y81784
FGC19831
FGC19831
A17594
A17594
S603
S603
FGC30690
FGC30690
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies