Top » Catalog » SNPs » FGC31786

$19.00

FGC31786
[FGC31786]

FGC31786
hg38 Position: ChrY:7289765..7289765
Ancestral: T
Derived: C
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC31786_F CAAAAGAGCACGATTCTGAAAC
Reverse Primer: FGC31786_R AACCCCTGGTCTCAAGCC
Reviews

Customers who bought this product also purchased
R1b-S1051 Mid Argyll Dal Riata Panel
R1b-S1051 Mid Argyll Dal Riata Panel
FGC23333
FGC23333
FGC32882
FGC32882
FGC19433
FGC19433
FGC23338
FGC23338
FGC33210
FGC33210
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies