Top » Catalog » SNPs » FGC5864

$19.00

FGC5864
[FGC5864]

FGC5864
hg38 Position: ChrY:11191397..11191397
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b (not listed)
Comments: Found in a R1b-M222 person
Forward Primer: FGC5864v2_F CTCAGATGACTGTTAGCACTTGTTAAA
Reverse Primer: FGC5864v2_R CACCTAAAATATACCCTCTTAAGTATTTTTG
Reviews

Customers who bought this product also purchased
L21
L21
A259
A259
DF13
DF13
A223
A223
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
L1335
L1335
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies