Top » Catalog » SNPs » A5411

$18.00

A5411
[A5411]

A5411
hg38 Position: ChrY:22314362..22314362
Ancestral: T
Derived: G
Reference: Paul Burns (2015)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Leinster Z255 Byrne cluster
Forward Primer: A5411_F GGGACACTGAAACTTTTAAATTAGTGAC
Reverse Primer: A5411_R GAAGGGCTTCTGCTTCTTGAG
Reviews

Customers who bought this product also purchased
L513
L513
M269
M269
P312
P312
L21
L21
Z253
Z253
Y22342
Y22342
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies