Top » Catalog » SNPs » Y190064

$18.00

Y190064
[Y190064]

Y190064
hg38 Position: ChrY:19108591..19108591
Ancestral: A
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: I2a
Comments: Below PH908 > FT14506 > Y56203
Forward Primer: Y190064_F GTTCATAACGTGAAAGTTTGTTACG
Reverse Primer: Y190064_R CTAAATGACGAGTTAATGGGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies