Top » Catalog » SNPs » Y61610

$18.00

Y61610
[Y61610]

Y61610
hg38 Position: ChrY:7282607..7282607
Ancestral: G
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: I2a
Comments: Below PH908 > FT14506 > Y56203
Forward Primer: Y61610_F CCAGGCTAGAGTGCAGTGC
Reverse Primer: Y61610_R GTTTTAAACAACCACAATGCCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies