Top » Catalog » SNPs » FGC30115

$18.00

FGC30115
[FGC30115]

FGC30115
hg38 Position: ChrY:7721206..7721206
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: M222 > DF97 > FGC19846 > FGC19845
Forward Primer: FGC30115_F CCAAACTCTGTTCATGACTTTGC
Reverse Primer: FGC30115_R CTCTCCTAAGGCAGAAGGTCTATG
Reviews

Customers who bought this product also purchased
S659
S659
FGC19845
FGC19845
M222
M222
DF97
DF97
R1b-DF49 (including M222) North West Irish Panel
R1b-DF49 (including M222) North West Irish Panel
A259
A259
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies