Top » Catalog » SNPs » FGC33214

$18.00

FGC33214
[FGC33214]

FGC33214
hg38 Position: ChrY:8222189..8222189
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b
Comments: M222 > DF105 > DF85 > DF97 > FGC19851 > A1147
Forward Primer: FGC33214_F CGAATGGCATTTACATGAGC
Reverse Primer: FGC33214_R ATGGCTTATAATTTTGTTTGTTCTC
Reviews

Customers who bought this product also purchased
S659
S659
FGC19845
FGC19845
M222
M222
DF97
DF97
FGC19842
FGC19842
R1b-DF49 (including M222) North West Irish Panel
R1b-DF49 (including M222) North West Irish Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies